488a t rrid ab 2632119 (Bethyl)

Bethyl is a verified supplier

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

Bethyl 488a t rrid ab 2632119
488a T Rrid Ab 2632119, supplied by Bethyl, used in various techniques. Bioz Stars score: 93/100, based on 83 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/a300+488a/CtIP+Antibody/pmc13006424-10-7-4
Average 93 stars, based on 83 article reviews

488a t rrid ab 2632119 - by Bioz Stars, 2026-09

93/100 stars

Images

other:

Article Title: Spatial Chromosome Folding and Active Transcription Drive DNA Fragility and Formation of Oncogenic MLL Translocations.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER ChIP-seq for H4K20me1 in K562 cells ENCODE Project Consortium GSM733675 Dnase-seq for GM12878 cells Thurman et al., 2012; Natarajan et al., 2012 GSM816665 Mnase-seq for GM12878 cells Kundaje et al., 2012 GSM920558 Hi-C for GM12878 cells Rao et al., 2014; Sanborn et al., 2015 GSE63525 ChIP-seq for Smc3 in GM12878 cells ENCODE Project Consortium GSM935376 ChIP-seq for CTCF in GM12878 cells ENCODE Project Consortium GSM935611 ChIP-seq for POL2RA in GM12878 cells ENCODE Project Consortium GSM935386 ChIP-seq for RAD21 in GM12878 cells ENCODE Project Consortium GSM803416 ChIA-PET for RAD21 in GM12878 cells Gertz et al., 2013 GSM1436265 ChIA-PET for CTCF in GM12878 cells Tang et al., 2015; Li et al., 2017 GSM1872886 RNA-seq for CD34 primary cells Schultz et al., 2015 GSM909310 ChIP-seq for CTCF in human CD34+ cells Jeong et al., 2017 GSM2861703 Hi-C for human CD34+ cells Jeong et al., 2017 GSM2861708 ChIP-seq for Top2B in MCF10A cells Dellino et al. 2019 GSM2442946 Experimental Models: Cell Lines Cal51 DSMZ Cat# ACC 302 HCT116-Top2A-mAID This paper N/A HCT116-Top2A-mAID Top2B / This paper N/A HCT116 wt Horizon Cat# HD Par-082 U2OS ATCC Cat# HTB-96 HTETOP Dr Andy Porter N/A HTETOP Top2B / This paper N/A HEK293T ATCC Cat# CRL-3216 MCF7 ATCC Cat# HTB-22 K562 ATCC Cat# CCL-243 TK6 wt (TSCER2) Hoa et al., 2016 N/A TK6 Mre11loxP/loxP Hoa et al., 2016 N/A TK6 Mre11loxP/H129N Hoa et al., 2016 N/A TK6 Mre11loxP/H129N Tdp2 / Hoa et al., 2016 N/A TK6 Tdp2 / Hoa et al., 2016 N/A TK6 Lig4 / Hoa et al., 2016 N/A TK6 Rad54 / Hoa et al., 2016 N/A TK6 Lig4 / Rad54 / Hoa et al., 2016 N/A TK6 CtIP-AID Hoa et al., 2016 N/A TK6 Cas9 This paper N/A TK6 MLL-CTCFmut This paper N/A Oligonucleotides siRNA negative control #1 Thermo Fisher Cat# 4390843 siRNA human TOP2A Thermo Fisher Cat# s14309 siRNA human TOP2B Thermo Fisher Cat# s108 ssDNA MLL-CTCF editing 50Phos-GCCAAGTCTGTT GTGAGCCCTTCCACAAGTTTTGTTTAGAGGAGAA CGAGCGACCTTTGGATGACCAGCTGGAAAATTGG TGTTGTCGTCGTTGCAAATTCTGTCACGTTTGTGG IDT N/A Recombinant DNA pGFP-C-shLenti shRNA human TOP2A-1 Origene Cat# TL308699A pGFP-C-shLenti shRNA human TOP2A-2 Origene Cat# TL308699C (Continued on next page) e3 Molecular Cell 75, 1–17.e1–e12, July 25, 2019

Article Title: DNA Double-Strand Break Resection Occurs during Non-homologous End Joining in G1 but Is Distinct from Resection during Homologous Recombination
Article Snippet: Rabbit-anti-CtIP , Bethyl , A300-488A.

Article Title: The BRCA1- RAD51 Axis Regulates SCAI/REV3 Dependent Replication Fork Maintenance
Article Snippet: Colcemid was obtained from Millipore Sigma (10295892001).

Article Title: BRCA1 mutational complementation induces synthetic viability
Article Snippet: Rabbit Anti-CtIP Polyclonal antibody , Bethyl , Cat# A300-488A, RRID:AB_2175262.

Virus:

Article Title: C1QBP Promotes Homologous Recombination by Stabilizing MRE11 and Controlling the Assembly and Activation of MRE11/RAD50/NBS1 Complex.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse anti-C1QBP(Immunofluorescence) Abcam Cat#: ab24733; RRID: AB_448269 Rabbit anti-C1QBP(Immunoblot) ABclonal Cat#: A1883; RRID: AB_2763916 Rabbit anti-MRE11(Immunoblot) Novus Cat#: NB100-142; RRID: AB_10077796 Rabbit anti-MRE11(Immunofluorescence) Abcam Cat#: ab33125; RRID: AB_776530 Rabbit anti-RAD50 ABclonal Cat#: A3078; RRID: AB_2764881 Rabbit anti-NBS1 Proteintech Cat#: 55025-1-AP; RRID: AB_10858928 Mouse anti-Flag Sigma-Aldrich Cat#: F3165; RRID: AB_259529 Mouse anti-Flag Sigma-Aldrich Cat#: A8592; RRID: AB_439702 Mouse anti-c-Myc Santa Cruz Cat#: sc-40(9E10); RRID: AB_627268 Mouse anti-GFP Sungene Biotech Cat#: KM8009 Rabbit anti-dimethyl-Arginine,asymmetric (ASYM25) Millipore Cat#:09-814; RRID: AB_10615495 Rabbit anti-RPA32 Proteintech Cat#:10412-1-AP; RRID: AB_2269665 Mouse anti-Chk1 Santa Cruz Cat#: sc-8408; RRID: AB_627257 Rabbit anti-phospho-RPA32(S4/S8) Abcam Cat#: ab87277; RRID: AB_1952482 Rabbit anti-phospho-RPA32(T21) HUABIO Cat#: ET1611-18 Rabbit anti-phospho-Chk1(S345) CST Cat#: 2348S; RRID: AB_331212 Rabbit anti-phospho- Chk1(S317) CST Cat#:12302S Rabbit anti-phospho- NBS1(S343) CST Cat#: 3001S; RRID: AB_10829154 Rabbit anti-phospho-ATM(S1981) CST Cat#: 5883S; RRID: AB_10835213 Rabbit anti-RAD51(Immunoblot) Abcam Cat#: ab133534; RRID: AB_2722613 Mouse anti-RAD51(Immunofluorescence) Novus Cat#: NB100-148; RRID: AB_1002131 Mouse anti-CyclinA Santa Cruz Cat#: sc-271682; RRID: AB_10709300 Rabbit anti-CyclinA2 Abcam Cat#: ab181591 Mouse anti-phospho-Histone H2A.X (Ser139) Abcam Cat#: ab26350; RRID: AB_470861 Mouse anti-phospho-Histone H2A.X clone JBW301 Millipore Cat#: 05-636-I; RRID: AB_2755003 Rabbit anti-IgG Biodragon Cat#: BF01001 Mouse anti-His Sigma-Aldrich Cat#: A7058; RRID: AB_258326 Rabbit anti-CtIP Bethyl Cat#: A300-488A; RRID: AB_2175262 Mouse anti-MBP NEB Cat#: E8038; RRID: AB_1559738 Rabbit anti-BrdU Abcam Cat#: ab152095 Mouse anti-Histone H3 Biodragon Cat#: B1055 Mouse anti-GAPDH Sungene Cat#: KM9002; RRID: AB_2721026 Mouse anti-a-Tubulin Sungene Cat#: KM9007L Bacterial and Virus Strains DH5a GenStar Cat#: S101-02 BL21(DE3) GenStar Cat#: S106-02 Rosetta (DE3) pLysS Novagen Cat#: 71401 DH10Bac GIBCO Cat#: 10361012 Chemicals, Peptides, and Recombinant Proteins ATR Inhibitor VE-821 TargetMol Cat#: T3032 ATM Inhibitor KU-55933 Selleck Chemicals Cat#: S1092 Camptothecin(CPT) HARVEYBIO Cat#: HZB0043 Etoposide HARVEYBIO Cat#: HZB0098-25 (Continued on next page) Molecular Cell 75, 1–16.e1–e6, September 19, 2019 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Adox APExBIO Cat#: APEB6120 BrdU HARVEYBIO Cat#: HZB1589-100 Cycloheximide HARVEYBIO Cat#: HZB0899-100 Micrococcal Nuclease NEB Cat#: M0247S Olaparib MedChem Express Cat#: HY-10162 MG132 LABLEAD Cat#: 474790LB CPT-11 Meilunbio Cat#: MB1126 Hydroxyurea HARVEY Cat#: HZB1502 Thymidine HARVEYBIO Cat#: HZB1595-1 Nocodazole TargetMol Cat#: T2802 Isopropyl b-D-thiogalactopyranoside (IPTG) Merck Cat#: CB420322 Trypsin M&C Cat#: CC017 GenOpti(IPTG-MEM) M&C Cat#: CT007 GAR/GAR(R576Q) peptides DGpeptides Co.,Ltd N/A Critical Commercial Assays Cytoplasmic and nuclear separation kit BestBio Cat#: BB-36021 Deposited Data Original data This study https://doi.org/10.17632/495fbz3p92.1 Experimental Models: Cell Lines HEK293T ATCC CRL-11268c HeLa ATCC CCL-2 Sf9 GIBCO Cat#: 11496015 High Five GIBCO Cat#: B85502 Oligonucleotides siRNA targeting sequence: C1QBP: UCACGGUC ACUUUCAACAT Itahana and Zhang, 2008 N/A Recombinant DNA pEGFP-N1-C1QBP This study Available upon request PDEST-N-SFB-MRE11/D1/D2/D3/D4/D5/D6/ DGAR/R570Q/R572Q/R576Q/R572/576Q/ S676/S678A mutants This study Available upon request PDEST-C-SFB-C1QBP/C1QBP(S150A) mutants This study Available upon request GST-C1QBP(74-282aa) This study Available upon request pESC-MR-6xHis This study Available upon request pET-C1QBP-flag This study Available upon request pFastBac-NBS1 This study Available upon request Software and Algorithms Adobe Illustrator CC 2018 Adobe https://www.adobe.com/ Adobe Photoshop CC 2018 Adobe https://www.adobe.com/ ImageJ NIH https://imagej.nih.gov/ij/ Prism 7.0 Graphpad https://www.graphpad.com/scientific-software/ prism/ NIS ELEMENTS Nikon https://www.microscope.healthcare.nikon.com/ Other LR CLONASE II ENZYME MIX invitrogen Cat#: 11791020 BP CLONASE II ENZYME MIX invitrogen Cat#: 11789020 S-protein Agarose Merck-Millipore Cat#: 69704-4 STREPTAVIDIN SEPHAROSE HP GE Cat#: 17-5113-01 (Continued on next page) e2 Molecular Cell 75, 1–16.e1–e6, September 19, 2019

Review

488a t rrid ab 2632119 (Bethyl)

Structured Review

Images

Related Articles

other:

Virus:

Recombinant:

Similar Products

Image Search Results